Everything below concerns GHRH receptor. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Last reviewed on 2025-12-19. Where a claim depends on a specific study, the study is described rather than over-claimed.
Downstream of growth hormone, the liver and other tissues increase production of insulin-like growth factor 1, a mediator of many growth-promoting effects. Studies have documented elevated levels of both hormones after dosing, and the rise from the long-acting form persists longer than that produced by shorter-acting analogues. What remains unclear is whether sustained elevation of these markers translates into meaningful clinical benefit, and whether prolonged exposure carries risks that short trials could not detect.
CJC-1295 acts at the growth hormone-releasing hormone receptor, a G-protein-coupled receptor found on somatotroph cells in the anterior pituitary. Binding triggers a rise in cyclic AMP and calcium entry, which promotes release of stored growth hormone. Because the peptide mimics the body's own releasing hormone, it amplifies existing secretory pulses rather than driving continuous output. The size of the response therefore depends partly on the subject's own hormonal rhythm and feedback state.
The core sequence keeps the receptor-binding region of GHRH while replacing four positions that are vulnerable to dipeptidyl peptidase-4 and other proteases. Substitutions at positions 2, 8, 15, and 27 raise metabolic stability relative to the natural hormone. The N-terminal residues remain essential for activity, so changes there generally lower potency. Molecular weight sits near 3368 daltons for the tetrasubstituted analog without the linker, while the albumin-binding form is heavier because of the added maleimide group.
CJC-1295 is a synthetic peptide modeled on growth hormone-releasing hormone, the hypothalamic signal that prompts the pituitary to release growth hormone. Its sequence corresponds to the first twenty-nine residues of human GHRH, with four substitutions that slow enzymatic breakdown. Early descriptions placed the compound in research on growth hormone deficiency and related conditions, and later literature groups it with the long-acting GHRH analogs. The name appears in both laboratory and popular fitness writing, where it sometimes labels chemically different peptides.
| Property | Value | Notes |
|---|---|---|
| Primary target | GHRH receptor | G-protein-coupled receptor on pituitary somatotrophs |
| Half-life, long-acting form | Several days | Extended by covalent albumin binding |
| Half-life, short form | About 30 minutes | Cleared rapidly by peptidases and kidneys |
| Route in studies | Subcutaneous injection | Used in the published human trials |
| Main measured effect | Rise in GH and IGF-1 | Surrogate markers rather than clinical endpoints |
Enzymatic protection is a separate mechanism from plasma protein binding. The four substitutions in the backbone reduce recognition by dipeptidyl peptidase IV, which normally cleaves the natural hormone within minutes. Without the reactive group, this resistance still yields only a short window of activity, generally reported in the range of tens of minutes. With it, reported half-lives in early human work extended to several days. The size of that gap is the main practical distinction between the two materials.
Both forms act at the pituitary receptor for growth hormone-releasing hormone and increase growth hormone output, which in turn raises insulin-like growth factor 1. A long-acting analog produces sustained rather than pulsatile stimulation, and the physiological consequences of that pattern are not fully settled. Published human data on the extended form remain limited, and much of what circulates in discussion traces to early company reports rather than independent replication. How sustained exposure affects normal feedback remains an open question.
The distinguishing feature of the DAC form is a maleimide-containing group that reacts with the free thiol of cysteine-34 on human serum albumin. This reaction forms a covalent bond without enzymatic assistance, and it takes place after the peptide enters the bloodstream. Because albumin is abundant and long-lived, the attached peptide is carried through circulation far longer than an unmodified fragment would survive. The chemistry is a deliberate pharmacokinetic strategy rather than a change to receptor activity.
Research material is normally supplied as a freeze-dried powder in sealed vials. In that state the peptide is comparatively robust, but prolonged exposure to warmth, moisture, or light accelerates degradation. Storage at minus twenty degrees Celsius or lower, with desiccant and protection from light, is the commonly described practice. Vials should be allowed to reach room temperature before opening to limit condensation on the powder. Moisture uptake during handling is a recognized source of variability in later measurements.
Reconstitution is typically performed with sterile water or bacteriostatic water, added slowly against the vial wall. The resulting solution should be clear and colorless; cloudiness or visible particles suggest a problem with the material or the diluent. Once in solution, the peptide is less stable than the dry powder. Refrigerated storage at two to eight degrees Celsius is common for short-term holding, while freezing aliquots is described for longer periods.
Two related forms appear under the CJC-1295 name. The simpler analogue, commonly written as modified GRF(1-29), carries the four substitutions but no additional conjugation. The second form attaches a maleimidopropionic acid linker to a lysine residue, a modification frequently called the drug affinity complex. That linker reacts with the free thiol on serum albumin to form a covalent bond. Because albumin has a long residence time in blood, the conjugated peptide stays in circulation far longer than the unconjugated analogue.
Receptor level activity follows the canonical GHRH pathway. The peptide binds the GHRH receptor, a class B G protein coupled receptor on somatotroph cells of the anterior pituitary. Binding raises intracellular cyclic AMP, which promotes calcium entry and the release of growth hormone into the bloodstream. Because the molecule acts at the same receptor as the endogenous hormone, its effect is superimposed on the natural pulsatile rhythm rather than replacing it. Whether sustained receptor occupation leads to desensitization is not fully settled.
Batch-to-batch consistency depends on solid-phase peptide synthesis and subsequent purification. Coupling efficiency, resin choice, and cleavage conditions all affect the final profile. Counter-ion content and moisture can shift the apparent mass of a batch. Documentation typically includes a certificate of analysis with chromatograms and spectra. Independent verification by a second laboratory is sometimes requested. Whether a given certificate reflects the actual vial contents depends on chain of custody. Analytical methods themselves carry uncertainty that should be stated alongside results.
Lyophilized material is typically stored at minus twenty degrees Celsius or lower. Keeping the vial dry and protected from light preserves peptide integrity. Repeated freeze-thaw cycles can cause aggregation or loss of activity. Once dissolved, solutions are generally kept at two to eight degrees Celsius. Stability data for reconstituted solutions vary, and long-term behavior is not fully established. Working aliquots reduce the number of times a stock container is opened.
==== Spirituality ==== While religion is often formalised and community-oriented, spirituality tends to be individually based and not as formalised. In a 2014 study, 320 children, ages 8–12, in both public and private schools, were given a Spiritual Well-Being Questionnaire assessing the correlation between spirituality and happiness. Spirituality – and not religious practices (praying, attending church services) – correlated positively with the child's happiness; the more spiritual the child was, the happier the child was. Spirituality accounted for about 3–26% of the variance in happiness. Meditation has been found to lead to high activity in the brain's left prefrontal cortex, which in turn has been found to correlate with happiness. A study using the Oxford happiness questionnaire on Brahma Kumaris Raja yoga meditators showed them having higher happiness than the control group. Yongey Mingyur Rinpoche has said that neuro scientists have found that with meditation, an individual's happiness baseline can change. Many people describe themselves as both religious and spiritual, but spirituality represents just one particular function of religion. Spirituality as related to positive psychology can be defined as "a search for the sacred". What is defined as sacred can be related to God, life itself, or almost any other facet of existence. It is viewed as having spiritual implications which are transcendent of the individual. Spiritual well-being addresses this human need for transcendence and involves social as well as existential well-being.
Roman A. Zubarev (born 1963) is a Russian-Swedish chemist and professor of medical proteomics in the Department of Medical Biochemistry and Biophysics at Karolinska Institutet, Stockholm, Sweden. His research spans mass spectrometry, proteomics, origin-of-life chemistry, disease biomarker discovery, and related fields.
=== Other medicines === Other treatments include lindane, benzyl benzoate, crotamiton, malathion, and sulfur preparations. Lindane is effective, but concerns over potential neurotoxicity have limited its availability in many countries. It is banned in California, but may be used in other states as a second-line treatment. Sulfur ointments or benzyl benzoate are often used in the developing world due to their low cost; some 10% sulfur solutions have been shown to be effective, and sulfur ointments are typically used for at least a week, though many people find the odor of sulfur products unpleasant. Crotamiton has been found to be less effective than permethrin in limited studies. Crotamiton or sulfur preparations are sometimes recommended instead of permethrin for children, due to concerns over dermal absorption of permethrin.
== Depleted uranium == Depleted uranium used in kinetic energy penetrators is supposed to be made from uranium enrichment tailings that have never been irradiated in a nuclear reactor, not reprocessed uranium. It should then contain no detectable amount of uranium-236. However, there have been claims of it being found in some depleted uranium.
=== Other uses in science and technology === ADM formalism of general relativity Ammonium dimolybdate Arrow diagramming method, a network-diagramming technique Atomic demolition munition Auto Dynamic Metering, Olympus OM-2 camera light metering
Sources: en.wikipedia.org
== Reception == John Dickson Carr, a writer of locked-room mysteries, has his detective Dr. Gideon Fell declare this the "best detective tale ever written", in his novel The Hollow Man (1935). Agatha Christie praised The Mystery of the Yellow Room through the mouthpiece of her detective Hercule Poirot in her 1963 novel The Clocks:
=== Anti-thyroid drugs === Treatment with methimazole or propylthiouracil for hyperthyroidism, is commonly associated with an elevation of liver enzymes. To differentiate between hyperthyroidism and drug-related liver injury, it is recommended to check baseline liver enzymes prior to initiation of treatment. If liver injury related to anti-thyroid treatment is significant, switching to the alternative agent can be attempted in most cases. Cases of fulminant liver failure reported with propylthiouracil have led to a regulatory warning, and to guidelines recommending methimazole as the first line anti-thyroid agent.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
=== Social issues === Talarico supports legalized abortion and believes the Bible sanctions abortion. As a representative, Talarico voted against a 2021 Texas bill to ban trans student-athletes from sports teams that do not match their sex assigned at birth, arguing that it was comparable to laws that had restricted the participation of Black people in sports, and that "some things are more important than perfectly fair competition in sports". But in a 2026 interview with Fox News, he said he opposed trans student-athletes in girls' sports "if it endangers safety or fairness", and said he had voted against the 2021 bill because the legislature did not consider amendments to reduce its scope.
Sources: en.wikipedia.org
=== Brandeis (1972-2019) === In 1972, Redfield joined Brandeis University with a joint appointment in physics and biochemistry. He designed his own spectrometer and apparatus that was the first to specifically target biological systems. The apparatus was similar in design to later commercial units, but because it was housed on shelves, it was easy to change out components and calibrate in many ways. The processing software and pulse sequences were original, and pulse sequences were selected by a switch. The pulse lengths were adjusted with an analog pot for S/N and selective pulse water suppression. He had one physics postdoc and one chemistry or biochemistry postdoc in his lab. In 1979, Redfield was elected to the National Academy of Sciences, and in 1983, he was named a Fellow in the American Academy of Arts and Sciences. He was given the Max Delbrück Prize by the American Physical Society in 2006.
Forced to retreat, Alexios ceded the city of Dyrrachium to the Count of the Tent (or Byzantine provincial administrators) mobilizing from Arbanon (i.e., ἐξ Ἀρβάνων ὁρμωμένω Κομισκόρτη; the term Κομισκόρτη is short for κόμης της κόρτης meaning "Count of the Tent"). The city's garrison resisted until February 1082, when Dyrrachium was betrayed to the Normans by the Venetian and Amalfitan merchants who had settled there. The Normans were now free to penetrate into the hinterland; they took Ioannina and some minor cities in southwestern Macedonia and Thessaly before appearing at the gates of Thessalonica. Dissension among the high ranks coerced the Normans to retreat to Italy. They lost Dyrrachium, Valona, and Butrint in 1085, after the death of Robert. A few years after the First Crusade, in 1107, the Normans under the command of Bohemond, Robert's son, landed in Valona and besieged Dyrrachium using the most sophisticated military equipment of the time, but to no avail. Meanwhile, they occupied Petrela, the citadel of Mili at the banks of the river Deabolis, Gllavenica (Ballsh), Kanina and Jericho. This time, the Albanians sided with the Normans, dissatisfied by the heavy taxes the Byzantines had imposed upon them. With their help, the Normans secured the Arbanon passes and opened their way to Dibra. The lack of supplies, disease and Byzantine resistance forced Bohemond to retreat from his campaign and sign a peace treaty with the Byzantines in the city of Deabolis.
Sulfate uptake occurs in roots. The maximal sulfate uptake rate is generally already reached at sulfate levels of 0.1 mM and lower. The uptake of sulfate by the roots and its transport to the shoot appears to be one of the primary regulatory sites of sulfur assimilation. Sulfate is actively taken up across the plasma membrane of the root cells, subsequently loaded into the xylem vessels and transported to the shoot by the transpiration stream. The uptake and transport of sulfate is ATP-dependent. Sulfate is reduced in the chloroplasts. Sulfate in plant tissue is predominantly present in the vacuole, since the concentration of sulfate in the cytoplasm is kept rather constant. Distinct sulfate transporter proteins mediate the uptake, transport and subcellular distribution of sulfate. The sulfate transporters gene family has been classified in up to 5 different groups according to their cellular and sub-cellular gene expression, and possible functioning. Each group of transporter proteins may be expressed exclusively in the roots or shoots of the plant, or both.
FGI of 6-Chloro-2-tetralone [17556-18-2] (1) to its enamine by reaction with pyrrolidine (or with the chiral amine 1-phenethylamine to ensure enantioselectivity) gives 1-(6-chloro-3,4-dihydronaphthalen-2-yl)pyrrolidine [54670-11-0] (2). Reaction with acrylamide [79-06-1] would be expected to be a 2-phase process. First a conjugate Michael addition occurs followed by displacement of pyrrolidine by the amide nitrogen to form an unsaturated lactam. The product of this step is called 8-chloro-1,4,5,6-tetrahydrobenzo[f]quinolin-3(2H)-one, PC10466539 (3). The lactam-olefin at the ring junction is reduced with triethylsilane in the presence of trifluoroacetic acid. The saturated lactam consists largely of racemic isomer with the trans ring junction. Alkylation of the lactam nitrogen with methyl halide in the presence of base gives 8-Chloro-4-methyl-1,4,4a,5,6,10b-hexahydrobenzo[f]quinolin-3(2H)-one [152323-03-0] (4). Treatment with methanol opens the lactam ring to yield the corresponding methyl ester, PC10826711 (5). The amino-ester is next resolved via its ditoluyl tartrate salt giving PC10516975 (6). Finally, heating with sodium carbonate regenerates the lactam ring to afford Bexlosteride (7). N.B. The starting tetralone finds dual use in the synthesis of 6-CAT.
Both The Guardian newspaper (UK) and the American non-profit publication ICIJ received documents in July 2014 revealing the details of past and present offshore clients of wealth managers Kleinwort Benson, including the Nando's restaurant group. The Guardian published its belief that, through the use of businesses in Malta, Guernsey and the Netherlands, Enthoven legally reduces the group's UK corporation tax bill by "up to a third." According to the British newspaper, Enthoven's profits eventually accumulate in the Kleinwort Benson-managed "Taro III Trust" that is based in Jersey and contains at least £750 million. While no member of the Enthoven family agreed to speak with The Guardian, a company representative explained that UK tax laws are not applicable to Enthoven, as "he is not resident in the US or the UK." The spokesperson also stated that, in the UK, Nando's paid corporation tax of £12.6 million on a profit of £58.2 million for the year ending February 2013. In its 2023 tax strategy, the company states that "Nando's policy is to maintain its tax affairs responsibly and transparently. Nando's doesn’t enter into transactions simply to secure tax advantages."
Sources: en.wikipedia.org
It binds the growth hormone-releasing hormone receptor on pituitary somatotroph cells. Receptor activation raises cyclic AMP and promotes release of stored growth hormone granules. Because the peptide persists longer than natural releasing hormone, stimulation is prolonged rather than brief.
The drug affinity complex links the peptide to serum albumin through a covalent bond. The conjugate is too large to be filtered quickly by the kidneys and is shielded from enzymatic breakdown. This extends the apparent half-life from roughly minutes to several days.
Long-term safety and any clinical benefit are unestablished. Published human data cover small groups over limited periods and focus on hormone levels rather than health outcomes. Whether prolonged elevation of growth hormone and insulin-like growth factor 1 is beneficial or harmful is an open question.
Natural GHRH is degraded quickly by dipeptidyl peptidase-4 and related enzymes, giving it a half-life measured in minutes. CJC-1295 carries substitutions that slow that breakdown, so it stays intact longer. Both act at the same pituitary receptor and produce the same class of signal.