Cyclic AMP raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
Reviewed 2025-08-28. Anything still debated is marked as such rather than presented as settled.
At the pituitary, the peptide binds the growth hormone-releasing hormone receptor on somatotroph cells. Receptor activation raises intracellular cyclic AMP and triggers release of stored growth hormone. Somatostatin and other hypothalamic signals modulate this response. Negative feedback from insulin-like growth factor 1 also influences output. The same regulatory architecture operates with the native hormone. Whether the synthetic analog alters feedback dynamics over repeated exposure remains an open question. Most published receptor work uses cell models rather than intact human systems.
CJC-1295 is a synthetic peptide belonging to the growth hormone-releasing hormone analog family. It comprises twenty-nine amino acid residues derived from the N-terminal region of natural GHRH. The molecule incorporates several non-natural substitutions that increase resistance to enzymatic degradation. These modifications extend its activity compared with the native hormone fragment. Researchers use it to study pituitary growth hormone secretion in laboratory and clinical settings. This compound is distinct from native GHRH in its stability profile.
Two principal forms appear in the literature and in research supply. One carries a drug affinity complex, a maleimide-based group that forms a covalent bond with circulating albumin. This linkage slows clearance and produces a long-lasting elevation of peptide levels. The other form lacks that group and is often labeled MOD GRF(1-29). It has a much shorter circulation time. Both variants retain the same core receptor-binding sequence. Reported half-lives differ substantially between the two.
Two related forms circulate in technical discussion under the same family name. The original version carries a drug affinity complex (DAC) that binds covalently to serum albumin after administration, and this linkage substantially extends circulation time. A second form, frequently written as modified GRF(1-29) or CJC-1295 without DAC, lacks that linker and clears much faster. The naming is a frequent source of confusion because the shorthand CJC-1295 can refer to either form depending on the source. Reports sometimes fail to specify which variant was studied.
The peptide backbone includes a D-alanine at position two, which resists cleavage by dipeptidyl peptidase IV, and several other substitutions that reduce degradation. Its molecular weight is roughly 3.4 kDa without the linker and about 3.6 kDa with it. The molecule is water soluble and is normally supplied as a lyophilized powder. Precise sequence and mass values depend on which variant is described, so technical documents usually state the exact form being referenced.
CJC-1295 is a synthetic peptide designed as a long-acting analogue of growth hormone-releasing hormone (GHRH). Its structure derives from the first 29 amino acids of native GHRH, a fragment often called GRF(1-29). Four substitutions were introduced to slow enzymatic breakdown and extend activity relative to the natural sequence. The compound was developed by ConjuChem as part of a broader effort to improve the pharmacokinetic profile of peptide hormones. It is studied in laboratory and clinical research settings rather than appearing as a naturally occurring substance.
| Property | Value | Notes |
|---|---|---|
| Molecular weight, DAC form | About 3647 Da | Varies with salt form |
| Molecular weight, non-DAC form | About 3358 Da | MOD GRF(1-29) |
| Solubility class | Water soluble | Also dissolves in polar solvents |
| Reported half-life, DAC form | About five to eight days | Values from human studies |
| Common synonyms | CJC-1295; MOD GRF(1-29) | Name depends on variant |
Reports on this compound commonly follow serum growth hormone and insulin-like growth factor 1 across defined time windows. Protocols differ in sampling frequency, assay platform, and participant characteristics, which makes direct comparison between publications difficult. Some work focuses on pulsatile release patterns instead of average concentrations. Whether repeated exposure alters endogenous hormone rhythms over long periods remains an open question, and the formal literature is thinner than the volume of informal commentary implies.
Once in circulation, the peptide binds the growth hormone-releasing hormone receptor displayed on pituitary somatotroph cells. Receptor activation couples to Gs proteins, elevates intracellular cyclic AMP, and drives protein kinase A signaling inside the cell. That cascade increases discharge of growth hormone into the bloodstream. The analog therefore operates through a receptor pathway that already exists for the body's own releasing hormone, rather than through an engineered artificial target.
Downstream of growth hormone, the liver and other tissues increase production of insulin-like growth factor 1, a mediator of many growth-promoting effects. Studies have documented elevated levels of both hormones after dosing, and the rise from the long-acting form persists longer than that produced by shorter-acting analogues. What remains unclear is whether sustained elevation of these markers translates into meaningful clinical benefit, and whether prolonged exposure carries risks that short trials could not detect.
CJC-1295 acts at the growth hormone-releasing hormone receptor, a G-protein-coupled receptor found on somatotroph cells in the anterior pituitary. Binding triggers a rise in cyclic AMP and calcium entry, which promotes release of stored growth hormone. Because the peptide mimics the body's own releasing hormone, it amplifies existing secretory pulses rather than driving continuous output. The size of the response therefore depends partly on the subject's own hormonal rhythm and feedback state.
Reported half-lives differ widely between the two variants and between species. Values for the albumin-binding form are usually expressed in days, while the unconjugated form is measured in minutes to a few hours. Sampling schedules, assay sensitivity, and route of administration all influence the numbers, which limits direct comparison across studies. Whether sustained receptor occupancy produces different downstream effects from pulsatile stimulation remains an open question in the published work. Claims about relative potency should therefore be read alongside the specific study design that produced them.
Lyophilised powder is the usual supplied form. The material is hygroscopic, so vials are typically equilibrated to room temperature before opening in order to prevent condensation on the contents. Long-term storage is generally described at minus twenty degrees Celsius or colder, protected from light and moisture. Repeated freeze-thaw cycles are avoided because they promote aggregation and loss of soluble material. A reconstituted solution is considerably less stable than the dry powder and is normally kept refrigerated for short periods only.
Identity and purity are assessed mainly by reversed-phase high-performance liquid chromatography combined with mass spectrometry. The chromatographic separation resolves the target peptide from truncation products and from species carrying oxidised residues, while mass measurement confirms the expected molecular mass. Because the two common variants differ by roughly 280 daltons, a mass determination distinguishes them unambiguously. Purity is often quoted as a percentage of total peak area, although that figure depends on the detection wavelength and the integration method applied.
Studies in this area generally track growth hormone pulses, insulin-like growth factor 1 concentrations, and occasionally body composition endpoints. Most published human data come from early, small trials, and questions about long-term effects remain open. Whether repeated exposure alters pituitary responsiveness over time is not settled. Analytical work relies on immunoassays for the hormones and on mass spectrometry for the peptide itself, because the two measurements answer different questions.
Binding of the peptide to the growth hormone-releasing hormone receptor on pituitary somatotrophs triggers a G protein coupled cascade that raises cyclic AMP and opens calcium channels. The result is greater secretion of growth hormone into the bloodstream. Because the peptide acts at the same receptor as the natural hypothalamic hormone, its effect is amplified pulse size rather than an entirely separate release pathway. Receptor binding alone does not determine the response, since somatostatin tone and other inputs modulate the final output.
The albumin-binding version stays in circulation for days, because covalent attachment to serum albumin shields the peptide from rapid filtration and degradation. Reported half-lives for this form fall in the range of several days. The version without the linker is cleared in minutes, with estimates often near thirty minutes in animal work. These figures come from small studies and vary with assay method, species, and route, so they are best read as approximate rather than fixed constants.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
Layne Thomas Staley (; born Layne Rutherford Staley; August 22, 1967 – April 5, 2002) was an American singer-songwriter. He was the original lead vocalist of Alice in Chains, which rose to international fame in the early 1990s as part of Seattle's grunge movement. He was known for his distinctive vocal style as well as his harmonizing with bandmate Jerry Cantrell. Before his success with Alice in Chains, Staley was also a member of the glam metal bands Sleze and Alice N' Chains. He was also a part of the supergroups Mad Season and Class of '99. "Man in the Box", the second single from Alice in Chains' debut album, Facelift (1990), garnered Staley critical recognition for his vocal style. Alice in Chains' EP Jar of Flies (1994), debuted at number one on the Billboard 200, making it Alice in Chains' first record—and the first-ever EP—to top the chart. However, Staley's deteriorating condition due to heroin abuse led him to enter a rehabilitation clinic. He began to work on a side project with several Seattle musicians, Mike McCready of Pearl Jam, Barrett Martin of Screaming Trees, and John Baker Saunders of the Walkabouts, which came to be Mad Season, while Alice in Chains went into hiatus. During Alice in Chains' hiatus, reports of Staley's drug addiction began to gain widespread circulation in fan and media communities, in part due to changes in his physical condition brought on by prolonged heroin abuse. On April 10, 1996, the band returned with a performance on MTV Unplugged in New York; it was Alice in Chains' first concert in two-and-a-half years.
== Richest royals == The Crown Property Bureau presides over the wealth of Thailand's king and royal family, judged to be the world's richest. Its holdings include over 7,588 rai (1,214.1 ha; 3,000 acres) of land in central Bangkok and shares in Siam Cement and Siam Commercial Bank. The king also owns the 545-carat Golden Jubilee Diamond, the largest cut and faceted diamond in the world.
== Uses == Purified water is suitable for many applications, including autoclaves, hand-pieces, laboratory testing, laser cutting, and automotive use. Purification removes contaminants that may interfere with processes, or leave residues on evaporation. Although water is generally considered to be a good electrical conductor—for example, domestic electrical systems are considered particularly hazardous to people if they may be in contact with wet surfaces—pure water is a poor conductor. The conductivity of water is measured in Siemens per meter (S/m). Sea-water is typically 5 S/m, drinking water is typically in the range of 5-50 mS/m, while highly purified water can be as low as 5.5 μS/m (0.055 μS/cm), a ratio of about 1,000,000:1,000:1. Purified water is used in the pharmaceutical industry. Water of this grade is widely used as a raw material, ingredient, and solvent in the processing, formulation, and manufacture of pharmaceutical products, active pharmaceutical ingredients (APIs) and intermediates, compendial articles, and analytical reagents. The microbiological content of the water is of importance and the water must be regularly monitored and tested to show that it remains within microbiological control. Purified water is also used in the commercial beverage industry as the primary ingredient of any given trademarked bottling formula, in order to maintain critical consistency of taste, clarity, and color. This guarantees the consumer reliably safe and satisfying drinking.
Sources: en.wikipedia.org
Theacrine, also known as 1,3,7,9-tetramethyluric acid, is a purine alkaloid found in cupuaçu (Theobroma grandiflorum), in a Chinese variety of tea called kucha (Chinese: 苦茶; pinyin: kǔ chá; lit. 'bitter tea') (Camellia assamica var. kucha), and in stenophylla coffee. It shows anti-inflammatory and analgesic effects and appears to affect adenosine signalling in a manner similar to caffeine. In kucha leaves, theacrine is synthesized from caffeine in what is thought to be a three-step pathway. Theacrine and caffeine are structurally similar.
=== Explosives industry === At the 1936 meeting of the American Chemical Society, professor Edward Bartow of the University of Iowa presented a commercially viable means of extracting large amounts of inositol from the phytic acid naturally present in waste corn. As a possible use for the chemical, he suggested 'inositol nitrate' as a more stable alternative to nitroglycerin. Today, inositol nitrate is used to gelatinize nitrocellulose in many modern explosives and solid rocket propellants.
==== Electrolyte imbalances ==== Electrolytes like Na, K, Ca, and P can all cause mimicking symptoms when high or low. Most commonly, hypokalemia, or low K, is the culprit, since many common drugs decrease this electrolyte.
=== Biology and medicine === Cerebral palsy Certified Prosthetist, an American medical qualification Ceruloplasmin, an enzyme encoded by the CP gene Congenital prosopagnosia, a type of inability to recognize faces Chronic pancreatitis
Stuart Joseph Patton (November 2, 1920 – October 9, 2017) was an American dairy scientist known for his research in the fields of milk chemistry and the biological processes that regulate milk synthesis in the mammary gland. He was professor of dairy science/food science at Pennsylvania State University from 1949 to 1980 and adjunct professor in the Department of Neurosciences, School of Medicine, University of California, San Diego, and in the School of Family Studies and Consumer Sciences at San Diego State University until his retirement in 2001.
Sources: en.wikipedia.org
== Description and types == The indication is a total breast weight that exceeds approximately 3% of the total body weight. There are varying definitions of what is considered to be excessive breast tissue, that is the expected breast tissue plus extraordinary breast tissue, ranging from as little as 0.6 kilograms (1.3 lb) up to 2.5 kilograms (5.5 lb) with most physicians defining macromastia as excessive tissue of over 1.5 kilograms (3.3 lb). Some resources distinguish between macromastia (Greek, macro: large, mastos: breast), where excessive tissue is less than 2.5 kg, and gigantomastia (Greek, gigantikos: giant), where excessive tissue is more than 2.5 kg. The enlargement can cause muscular discomfort and over-stretching of the skin envelope, which can lead in some cases to ulceration. Hypertrophy of the breast can affect the breasts equally, but usually affects one breast more than the other, thereby causing asymmetry, when one breast is larger than the other. The condition can also individually affect the nipples and areola instead of or in addition to the entire breast. The effect can produce a minor size variation to an extremely large breast asymmetry. Breast hypertrophy is classified in one of five ways: as either pubertal (juvenile hypertrophy), gestational (gravid macromastia), in adult women without any obvious cause, associated with penicillamine therapy, and associated with extreme obesity. Many definitions of macromastia and gigantomastia are based on the term of "excessive breast tissue", and are therefore somewhat arbitrary.
=== Product liability === The US Fire Administration says electronic cigarettes have been combusting and injuring people and surrounding areas. The composition of a cigarette is the cause of this, as the cartridges that contain the liquid mixture are so close to the battery. A research report by the US Fire Administration supports this, stating that, "Unlike mobile phones, some e-cigarette lithium-ion batteries within e-cigarettes offer no protection to stop the coil overheating". Peer-reviewed medical literature has also documented characteristic injury patterns associated with e-cigarette explosions and battery failures. A 2023 retrospective burn center study reported that typical injury locations included the groin region, hands, and face, and that many cases required surgical treatment. Beyond individual case reports, population-level surveillance data have also been used to estimate the frequency of e-cigarette-related injuries. A 2024 analysis of US emergency department surveillance data estimated that there were 3,142 ED-treated ENDS/ENNDS product-related injuries from 2012 to 2022. In response to reports of battery-related fires and explosions, US regulators have issued consumer safety guidance. The US Food and Drug Administration has also issued consumer guidance on reducing battery fire and explosion risks, noting that "vape fires and explosions are dangerous" and providing recommendations on charging, storage, and handling. Since the publication of these early reports, the structure of the e-cigarette market has evolved.
People during the Middle Paleolithic, such as the Neanderthals and Middle Paleolithic Homo sapiens in Africa, began to catch shellfish for food as revealed by shellfish cooking in Neanderthal sites in Italy about 110,000 years ago and in Middle Paleolithic Homo sapiens sites at Pinnacle Point, South Africa around 164,000 BP. Although fishing only became common during the Upper Paleolithic, fish have been part of human diets long before the dawn of the Upper Paleolithic and have certainly been consumed by humans since at least the Middle Paleolithic. For example, the Middle Paleolithic Homo sapiens in the region now occupied by the Democratic Republic of the Congo hunted large 6 ft (1.8 m)-long catfish with specialized barbed fishing points as early as 90,000 years ago. The invention of fishing allowed some Upper Paleolithic and later hunter-gatherer societies to become sedentary or semi-nomadic, which altered their social structures. Example societies are the Lepenski Vir as well as some contemporary hunter-gatherers, such as the Tlingit. In some instances (at least the Tlingit), they developed social stratification, slavery, and complex social structures such as chiefdoms. Anthropologists such as Tim White suggest that cannibalism was common in human societies prior to the beginning of the Upper Paleolithic, based on the large amount of "butchered human" bones found in Neanderthal and other Lower/Middle Paleolithic sites. Cannibalism in the Lower and Middle Paleolithic may have occurred because of food shortages.
== History == The founding of the Jere Ngoni Kingdom was precipitated by the Mfecane, a period of widespread instability and state formation in Southern Africa, caused by pre-existing trends of political centralisation which were catalysed by the effects of international trade, environmental instability, and European colonial expansion. An early state was the Ndwandwe led by Zwide; after Zwide defeated Dingiswayo's Mthethwa c. 1816, the Mthethwa state disintegrated and some groups were incorporated into Ndwandwe. Zwide next engaged the expanding Zulu led by Shaka, but was defeated in battle c. 1819. Following this defeat, Zwangendaba (one of Ndwandwe's Indunas) led his group on a long-distance migration northwards, and they became known as the Jere Ngoni (separate from the Maseko Ngoni). Zwangendaba initially settled around the Mkomati River (north of Delagoa Bay), but fled north after clashing with other rulers such as Soshangane, Nxaba, and Mzilikazi. Zwangendaba entered onto the Zimbabwean Plateau and raided the Rozvi Empire for several years, before crossing the Zambezi in 1835. He left some troops behind with a relative of his (Nyamazana) who later killed the Rozvi king. In 1840 Zwangendaba's forces massacred many Tonga for allegedly causing him illness, and they captured many Chewa and Tumbuka. The Ngoni later reached the Ufipa Plateau, where in the late 1840s Zwangendaba died.
Unlabeled antibody is incubated in the presence of its antigen (sample) A sufficient incubation period is provided to allow the antibodies to bind to the antigens. The sample is then passed through the Scavenger container. This can be a test tube or a specifically designed flow through channel. The surface of the Scavenger container or channel has "Scavenger Antigens" bound to it. These can be identical or sufficiently similar to the primary antigens that the free antibodies will bind. The Scavenger container must have sufficient surface area and sufficient time to allow the Scavenger Antigens to bind to all the excess Antibodies introduced into the sample. The sample, that now contains the tagged and bound antibodies, is passed through a detector. This device can be a flow cytometer or other device that illuminates the tags and registers the response. This test allows multiple antigens to be tagged and counted at the same time. This allows specific strains of bacteria to be identified by two (or more) different color tags. If both tags are present on a cell, then the cell is that specific strain. If only one is present, it is not. This test is done, generally, one test at a time and cannot be done with the microtiter plate. The equipment needed is usually less complicated and can be used in the field.
Sources: en.wikipedia.org
It is a synthetic peptide modeled on growth hormone-releasing hormone. The molecule is used in research on pituitary growth hormone secretion. It differs from the natural hormone through several stabilizing substitutions.
The DAC form carries a maleimide group that binds albumin and extends circulation time. The non-DAC form lacks this group and clears much faster. Both share the same receptor-binding core.
It targets the growth hormone-releasing hormone receptor on pituitary somatotroph cells. Activation raises cyclic AMP and promotes growth hormone release. Normal feedback pathways remain part of the response.
No. It is a synthetic analogue modeled on the first 29 residues of human GHRH. The substitutions and any linker are laboratory modifications rather than features of the endogenous peptide.