Everything below concerns cjc-1295. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Updated 2026-02-11. Numbers and descriptions here follow the published literature rather than marketing material.
Purity is most often assessed by reversed-phase high-performance liquid chromatography, reported as a percentage of total peak area. Identity is confirmed by mass spectrometry, which yields a molecular ion consistent with the expected sequence. Amino acid analysis and peptide mapping provide additional characterization. Reported purity values are method-dependent, so figures from different laboratories are not always directly comparable without details of column, gradient, and detection wavelength.
Peptide degradation proceeds mainly through hydrolysis, oxidation of methionine, and deamidation of asparagine or glutamine residues. The maleimide group on the albumin-binding variant can also react with thiols or hydrolyze in aqueous media. Because these pathways accelerate with temperature and pH extremes, handling conditions strongly influence measured stability. Stability data in the public literature are limited and often generated under differing conditions, so general statements about shelf life should be read as approximate.
Research material is normally supplied as a freeze-dried powder in sealed vials. In that state the peptide is comparatively robust, but prolonged exposure to warmth, moisture, or light accelerates degradation. Storage at minus twenty degrees Celsius or lower, with desiccant and protection from light, is the commonly described practice. Vials should be allowed to reach room temperature before opening to limit condensation on the powder. Moisture uptake during handling is a recognized source of variability in later measurements.
The peptide backbone includes a D-alanine at position two, which resists cleavage by dipeptidyl peptidase IV, and several other substitutions that reduce degradation. Its molecular weight is roughly 3.4 kDa without the linker and about 3.6 kDa with it. The molecule is water soluble and is normally supplied as a lyophilized powder. Precise sequence and mass values depend on which variant is described, so technical documents usually state the exact form being referenced.
CJC-1295 is a synthetic peptide designed as a long-acting analogue of growth hormone-releasing hormone (GHRH). Its structure derives from the first 29 amino acids of native GHRH, a fragment often called GRF(1-29). Four substitutions were introduced to slow enzymatic breakdown and extend activity relative to the natural sequence. The compound was developed by ConjuChem as part of a broader effort to improve the pharmacokinetic profile of peptide hormones. It is studied in laboratory and clinical research settings rather than appearing as a naturally occurring substance.
Two related forms circulate in technical discussion under the same family name. The original version carries a drug affinity complex (DAC) that binds covalently to serum albumin after administration, and this linkage substantially extends circulation time. A second form, frequently written as modified GRF(1-29) or CJC-1295 without DAC, lacks that linker and clears much faster. The naming is a frequent source of confusion because the shorthand CJC-1295 can refer to either form depending on the source. Reports sometimes fail to specify which variant was studied.
| Property | Value | Notes |
|---|---|---|
| Appearance | White to off-white lyophilized powder | Visual descriptor; not a measure of purity |
| Solubility class | Freely soluble in water | Aqueous dissolution may require gentle mixing |
| Typical storage (powder) | −20 °C or below, desiccated | Protect from light and ambient moisture |
| Typical storage (solution) | 2–8 °C, short term | Freeze aliquots where longer holding is needed |
| Purity assessment | Reversed-phase HPLC, area percent | Values depend on column, gradient, and detection wavelength |
The core sequence keeps the receptor-binding region of GHRH while replacing four positions that are vulnerable to dipeptidyl peptidase-4 and other proteases. Substitutions at positions 2, 8, 15, and 27 raise metabolic stability relative to the natural hormone. The N-terminal residues remain essential for activity, so changes there generally lower potency. Molecular weight sits near 3368 daltons for the tetrasubstituted analog without the linker, while the albumin-binding form is heavier because of the added maleimide group.
CJC-1295 is a synthetic peptide modeled on growth hormone-releasing hormone, the hypothalamic signal that prompts the pituitary to release growth hormone. Its sequence corresponds to the first twenty-nine residues of human GHRH, with four substitutions that slow enzymatic breakdown. Early descriptions placed the compound in research on growth hormone deficiency and related conditions, and later literature groups it with the long-acting GHRH analogs. The name appears in both laboratory and popular fitness writing, where it sometimes labels chemically different peptides.
The second form adds a maleimide-bearing linker to the lysine at the carboxyl end. This group reacts with cysteine-34 on circulating serum albumin, forming a covalent bond that keeps the peptide in the bloodstream for far longer. ConjuChem developed the molecule as a way to extend the action of a peptide without frequent administration. The albumin attachment is the defining structural feature of the drug affinity complex version. Whether continuous exposure produces effects distinct from shorter pulses remains an unresolved research question.
CJC-1295 belongs to a family of synthetic peptides modeled on growth hormone-releasing hormone, the hypothalamic signal that prompts the pituitary to release growth hormone. The compound is built from the first twenty-nine amino acids of the natural human sequence, a fragment that retains full receptor binding capacity. Native growth hormone-releasing hormone is degraded quickly in circulation, so the fragment alone has limited practical value. Early work therefore focused on chemical modifications that preserve receptor binding while slowing enzymatic breakdown. The result is a molecule described in the literature as a long-acting analog of the natural hormone.
Four amino acid substitutions separate the modified backbone from the parent GRF(1-29) sequence. These changes reduce recognition by dipeptidyl peptidase IV and related proteases, extending the interval before degradation. Development work in this area sought longer-acting GHRH analogs for endocrine investigation. Published descriptions treat the substitution set as a defining property of the core sequence, while the albumin-binding linker is described separately as an optional addition to that same backbone.
CJC-1295 is a synthetic peptide analog of growth hormone-releasing hormone, constructed on the 29-amino-acid fragment designated GRF(1-29). The name began as an internal development code during the 1990s and later spread through research supply catalogs and discussion forums. The molecule does not occur in nature; its sequence is engineered rather than isolated from tissue. Two related compounds are sold under this single label, and they differ by one appended chemical group that strongly influences how long the peptide remains in circulation.
=== Support for 18th Amendment === Bhutto Zardari has repeatedly criticized the historical One Unit Scheme, and warned against any attempt to bring in a presidential system, explaining that it will not be in the interest of democracy. During a press conference on 27 April 2019, he stated that the "presidential system is neither in the interest of the country nor the federation and all democratic forces will resist any such move."
A range for normal temperatures has been found. Central temperatures, such as rectal temperatures, are more accurate than peripheral temperatures. Fever is generally agreed to be present if the elevated temperature is caused by a raised set point and:
== Alternatives == In 2018 road transport used 49% of petroleum, aviation 8%, and uses other than energy 17%. Electric vehicles are the main alternative for road transport and biojet for aviation. Single-use plastics have a high carbon footprint and may pollute the sea, but as of 2022 the best alternatives are unclear.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
The pharmacodynamics of spironolactone are characterized by high antimineralocorticoid activity, moderate antiandrogenic activity, and weak steroidogenesis inhibition, among other more minor activities. Spironolactone is a prodrug, so most of its actions are actually mediated by its various active metabolites. The major active forms of spironolactone are 7α-thiomethylspironolactone (7α-TMS) and canrenone (7α-desthioacetyl-δ6-spironolactone). Spironolactone is a potent antimineralocorticoid. That is, it is an antagonist of the mineralocorticoid receptor (MR), the biological target of mineralocorticoids like aldosterone and 11-deoxycorticosterone. By blocking the MR, spironolactone inhibits the effects of mineralocorticoids in the body. The antimineralocorticoid activity of spironolactone is responsible for its therapeutic efficacy in the treatment of edema, high blood pressure, heart failure, hyperaldosteronism, and ascites due to cirrhosis. It is also responsible for many of the side effects of spironolactone, such as urinary frequency, dehydration, hyponatremia, low blood pressure, fatigue, dizziness, metabolic acidosis, decreased kidney function, and its risk of hyperkalemia. Due to the antimineralocorticoid activity of spironolactone, levels of aldosterone are significantly increased by the medication, probably reflecting an attempt of the body to maintain homeostasis. Spironolactone is a moderate antiandrogen. That is, it is an antagonist of the androgen receptor (AR), the biological target of androgens like testosterone and dihydrotestosterone (DHT).
Sources: en.wikipedia.org
A 58-hour curfew was announced in Kherson. Oleksandr Prokudin, the Ukrainian governor of Kherson Oblast, said that during the curfew: "it is forbidden to move on the streets of the city. The city will also be closed for entry and exit". Twenty-four civilians were killed in Kherson city due to Russian shelling. Russia said it had shot down two drones over the Moscow Kremlin and accused Ukraine of sending them to assassinate President Vladimir Putin. The Institute for the Study of War commented that it was "extremely unlikely that two drones could have penetrated multiple layers of air defence and detonated or been shot down just over the heart of the Kremlin in a way that provided spectacular imagery caught nicely on camera". The Ukrainian government denied the accusations, calling them fabricated. The British Ministry of Defence reported that several unmanned aerial vehicles (UAVs) struck Russia's Seshcha Airbase in Bryansk Oblast, 150 km north of the Ukrainian border, adding that an An-124 heavy transport aircraft was likely damaged.
About 60 hubs of the Clinical and Translational Science Awards program. Texas Medical Center, Houston, Texas, United States Translational Research Institute (Australia), Brisbane, Queensland, Australia. University of Rochester, Rochester, New York, United States has a dedicated Clinical and Translational Science Institute Stanford University Medical Center, Stanford, California, United States. Translational Genomics Research Institute, Phoenix, Arizona, United States. Maine Medical Center in Portland, Maine, United States has a dedicated translational research institute. Scripps Research Institute, Florida, United States, has a dedicated translational research institute. UC Davis Clinical and Translational Science Center, Sacramento, California Clinical and Translational Science Institute, University of Pittsburgh, Pittsburgh, Pennsylvania Weill Cornell Medicine has a Clinical and Translational Science Center. Hansjörg Wyss Institute for Biologically Inspired Engineering at Harvard University in Boston, Massachusetts, United States. Additionally, translational research is now acknowledged by some universities as a dedicated field to study a PhD or graduate certificate in, in a medical context. These institutes currently include Monash University in Victoria, Australia, the University of Queensland, Diamantina Institute in Brisbane, Australia, at Duke University in Durham, North Carolina, America, at Creighton University in Omaha, Nebraska at Emory University in Atlanta, Georgia, and at The George Washington University in Washington, D.C.
== External links == Basel, Yochai; Hassner, Alfred (2001). "Imidazole and Trifluoroethanol as Efficient and Mild Reagents for Destruction of Excess Di-tert-butyl Dicarbonate [(BOC)2O]". Synthesis. 2001 (4): 0550. doi:10.1055/s-2001-12350. S2CID 97029361.
=== Pharmacokinetics === Little information thus far has been published on the clinical pharmacokinetics of phenibut. The drug is reported to be well-absorbed. It distributes widely throughout the body and across the blood–brain barrier. Approximately 0.1% of an administered dose of phenibut reportedly penetrates into the brain, with this said to occur to a much greater extent in young people and the elderly. Following a single 250 mg dose in healthy volunteers, its elimination half-life was approximately 5.3 hours and the drug was largely (63%) excreted in the urine unchanged. Some limited information has been described on the pharmacokinetics of phenibut in recreational users taking much higher doses (e.g., 1–3 grams) than typical clinical doses. In these individuals, the onset of action of phenibut has been reported to be 2 to 4 hours orally and 20 to 30 minutes rectally, the peak effects are described as occurring 4 to 6 hours following oral ingestion, and the total duration for the oral route has been reported to be 15 to 24 hours (or about 3 to 5 terminal half-lives).
Tifluadom is a benzodiazepine derivative with an unusual activity profile. Unlike most benzodiazepines, tifluadom has no activity at the GABAA receptor, but instead is a selective agonist for the κ-opioid receptor. It has potent analgesic and diuretic effects in animals, and also has sedative effects and stimulates appetite. While tifluadom has several effects which might have potential uses in medicine, such as analgesia and appetite stimulation, κ-opioid agonists tend to produce undesirable effects in humans such as dysphoria and hallucinations, and so these drugs tend to only be used in scientific research. Dysphoric effects are similar to those seen when using other κ-opioid receptor agonists like pentazocine and salvinorin A, and can be considered the opposite of morphine-induced euphoria. As such, kappa agonists are believed to have very limited abuse potential.
Sources: en.wikipedia.org
Cool, dark, and dry conditions are standard, with storage at minus twenty degrees Celsius or below. Desiccant and sealed vials limit moisture uptake. Repeated warming and cooling of the container is generally avoided.
There is no single agreed limit, and laboratory practice varies widely. Refrigeration slows degradation, and freezing aliquots is often described for longer holding. Any visible cloudiness or precipitate indicates the solution should be discarded.
Mass spectrometry provides the most direct confirmation through molecular mass. Reversed-phase chromatography supports purity assessment, and peptide mapping or amino acid analysis can corroborate sequence. No single method establishes both purity and identity on its own.
No. It is a synthetic analogue modeled on the first 29 residues of human GHRH. The substitutions and any linker are laboratory modifications rather than features of the endogenous peptide.