If you have been reading about Reconstitution and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Last reviewed on 2025-12-15. Where a claim depends on a specific study, the study is described rather than over-claimed.
Receptor level activity follows the canonical GHRH pathway. The peptide binds the GHRH receptor, a class B G protein coupled receptor on somatotroph cells of the anterior pituitary. Binding raises intracellular cyclic AMP, which promotes calcium entry and the release of growth hormone into the bloodstream. Because the molecule acts at the same receptor as the endogenous hormone, its effect is superimposed on the natural pulsatile rhythm rather than replacing it. Whether sustained receptor occupation leads to desensitization is not fully settled.
CJC-1295 belongs to a class of synthetic peptides modeled on growth hormone releasing hormone, a forty-four amino acid signal produced by the hypothalamus. The compound is built from the first twenty-nine residues of the natural sequence, with four substitutions introduced at positions 2, 8, 15 and 27. These changes were designed to slow enzymatic breakdown while preserving receptor activation. The result is a peptide that is shorter than native GHRH and considerably more resistant to ordinary clearance pathways in circulation.
Two related forms appear under the CJC-1295 name. The simpler analogue, commonly written as modified GRF(1-29), carries the four substitutions but no additional conjugation. The second form attaches a maleimidopropionic acid linker to a lysine residue, a modification frequently called the drug affinity complex. That linker reacts with the free thiol on serum albumin to form a covalent bond. Because albumin has a long residence time in blood, the conjugated peptide stays in circulation far longer than the unconjugated analogue.
Research material is normally supplied as a freeze-dried powder in sealed vials. In that state the peptide is comparatively robust, but prolonged exposure to warmth, moisture, or light accelerates degradation. Storage at minus twenty degrees Celsius or lower, with desiccant and protection from light, is the commonly described practice. Vials should be allowed to reach room temperature before opening to limit condensation on the powder. Moisture uptake during handling is a recognized source of variability in later measurements.
Reconstitution is typically performed with sterile water or bacteriostatic water, added slowly against the vial wall. The resulting solution should be clear and colorless; cloudiness or visible particles suggest a problem with the material or the diluent. Once in solution, the peptide is less stable than the dry powder. Refrigerated storage at two to eight degrees Celsius is common for short-term holding, while freezing aliquots is described for longer periods.
Purity is most often assessed by reversed-phase high-performance liquid chromatography, reported as a percentage of total peak area. Identity is confirmed by mass spectrometry, which yields a molecular ion consistent with the expected sequence. Amino acid analysis and peptide mapping provide additional characterization. Reported purity values are method-dependent, so figures from different laboratories are not always directly comparable without details of column, gradient, and detection wavelength.
| Property | Value | Notes |
|---|---|---|
| Peptide class | Synthetic GHRH analogue | Built on a 29 residue sequence |
| Primary target | GHRH receptor (GHRHR) | Class B G protein coupled receptor |
| Unconjugated half life | Minutes | Limited by protease degradation |
| Key modification | Four residue substitutions | Positions 2, 8, 15 and 27 |
| Common synonym | Modified GRF(1-29) | Usually denotes the form without DAC |
Enzymatic protection is a separate mechanism from plasma protein binding. The four substitutions in the backbone reduce recognition by dipeptidyl peptidase IV, which normally cleaves the natural hormone within minutes. Without the reactive group, this resistance still yields only a short window of activity, generally reported in the range of tens of minutes. With it, reported half-lives in early human work extended to several days. The size of that gap is the main practical distinction between the two materials.
Both forms act at the pituitary receptor for growth hormone-releasing hormone and increase growth hormone output, which in turn raises insulin-like growth factor 1. A long-acting analog produces sustained rather than pulsatile stimulation, and the physiological consequences of that pattern are not fully settled. Published human data on the extended form remain limited, and much of what circulates in discussion traces to early company reports rather than independent replication. How sustained exposure affects normal feedback remains an open question.
The distinguishing feature of the DAC form is a maleimide-containing group that reacts with the free thiol of cysteine-34 on human serum albumin. This reaction forms a covalent bond without enzymatic assistance, and it takes place after the peptide enters the bloodstream. Because albumin is abundant and long-lived, the attached peptide is carried through circulation far longer than an unmodified fragment would survive. The chemistry is a deliberate pharmacokinetic strategy rather than a change to receptor activity.
The core sequence keeps the receptor-binding region of GHRH while replacing four positions that are vulnerable to dipeptidyl peptidase-4 and other proteases. Substitutions at positions 2, 8, 15, and 27 raise metabolic stability relative to the natural hormone. The N-terminal residues remain essential for activity, so changes there generally lower potency. Molecular weight sits near 3368 daltons for the tetrasubstituted analog without the linker, while the albumin-binding form is heavier because of the added maleimide group.
CJC-1295 is a synthetic peptide modeled on growth hormone-releasing hormone, the hypothalamic signal that prompts the pituitary to release growth hormone. Its sequence corresponds to the first twenty-nine residues of human GHRH, with four substitutions that slow enzymatic breakdown. Early descriptions placed the compound in research on growth hormone deficiency and related conditions, and later literature groups it with the long-acting GHRH analogs. The name appears in both laboratory and popular fitness writing, where it sometimes labels chemically different peptides.
Downstream of growth hormone, the liver and other tissues increase production of insulin-like growth factor 1, a mediator of many growth-promoting effects. Studies have documented elevated levels of both hormones after dosing, and the rise from the long-acting form persists longer than that produced by shorter-acting analogues. What remains unclear is whether sustained elevation of these markers translates into meaningful clinical benefit, and whether prolonged exposure carries risks that short trials could not detect.
CJC-1295 acts at the growth hormone-releasing hormone receptor, a G-protein-coupled receptor found on somatotroph cells in the anterior pituitary. Binding triggers a rise in cyclic AMP and calcium entry, which promotes release of stored growth hormone. Because the peptide mimics the body's own releasing hormone, it amplifies existing secretory pulses rather than driving continuous output. The size of the response therefore depends partly on the subject's own hormonal rhythm and feedback state.
Four amino acid substitutions separate the modified backbone from the parent GRF(1-29) sequence. These changes reduce recognition by dipeptidyl peptidase IV and related proteases, extending the interval before degradation. Development work in this area sought longer-acting GHRH analogs for endocrine investigation. Published descriptions treat the substitution set as a defining property of the core sequence, while the albumin-binding linker is described separately as an optional addition to that same backbone.
CJC-1295 is a synthetic peptide analog of growth hormone-releasing hormone, constructed on the 29-amino-acid fragment designated GRF(1-29). The name began as an internal development code during the 1990s and later spread through research supply catalogs and discussion forums. The molecule does not occur in nature; its sequence is engineered rather than isolated from tissue. Two related compounds are sold under this single label, and they differ by one appended chemical group that strongly influences how long the peptide remains in circulation.
The dividing feature between the two forms is a maleimide-based drug affinity complex, abbreviated DAC. In the DAC-bearing version, a linker attaches the peptide to serum albumin after administration, and that association slows removal from plasma. The version lacking DAC appears in catalogs as MOD GRF(1-29) or tetrasubstituted GRF(1-29). Because informal writing treats both as one item, comparisons drawn from such sources routinely blend measurements taken from two molecules with substantially different behavior.
== Mechanisms == VIP binds to both VPAC1 and VPAC2 receptors. When VIP binds to VPAC2 receptors, a G-alpha-mediated signaling cascade is triggered. In a number of systems, VIP binding activates adenyl cyclase activity leading to increases in cAMP concentration and PKA activity. The PKA then activates other intracellular signaling pathways like the phosphorylation of CREB and other transcriptional factors. The mPer1 and mPer2 promoters have CRE domains and thus provides the mechanism for VIP to regulate the molecular clock itself. Then it will activate gene expression pathways such as Per1 and Per2 in circadian rhythm. In addition, GABA levels are connected to VIP in that they are co-released. Sparse GABAergic connections are thought to decrease synchronized firing. While GABA controls the amplitude of SCN neuronal rhythms, it is not critical for maintaining synchrony. However, if GABA release is dynamic, it may mask or amplify synchronizing effects of VIP inappropriately. Circadian time is likely to affect the synapses rather than the organization of VIP circuits.
=== Pharmacokinetics === Suvomipic is used topically on the scalp instead of orally for potential safety and tolerability reasons. As an example, MPCs and pyruvate availability also prominently regulate stem cells and cellular growth in the intestines. The drug is said to be unstable in blood, which limits the risk of systemic absorption and side effects. It is said to have been engineered to be 1,000 times more effective at "penetrating" skin than blood. No suvomipic was detected in circulation with topical administration to the scalp in clinical studies.
=== Other work === In October 2015, she became the celebrity ambassador for Gillette Venus and Oral-B. On 21 March 2023, Willis partnered with Absolute Collagen for their 'Strong in your own skin' campaign.
Gas-cooled fast reactor cooled by helium. Sodium-cooled fast reactor based on the existing LMFBR and integral fast reactor designs. Lead-cooled fast reactor based on Soviet naval propulsion units. Fast reactors are not necessarily breeders. For example, sodium-cooled fast reactors can operate as transmuters, converters or breeders. Mixed-oxide fuel combines uranium dioxide and plutonium dioxide. Its plutonium content depends on the reactor design and may vary across the core. Another fuel option is metal alloys, typically a blend of uranium, plutonium, and zirconium (used because it is "transparent" to neutrons). Enriched uranium can be used on its own. Many designs surround the reactor core in a blanket of tubes that contain non-fissile uranium-238, which, by capturing fast neutrons from the reaction in the core, converts to fissile plutonium-239 (as is some of the uranium in the core), which is then reprocessed and used as nuclear fuel. Other FBR designs rely on the geometry of the fuel (which also contains uranium-238), arranged to attain sufficient fast neutron capture. The plutonium-239 (or the fissile uranium-235) fission cross-section is much smaller in a fast spectrum than in a thermal spectrum, as is the ratio between the 239Pu/235U fission cross-section and the 238U absorption cross-section. This increases the concentration of 239Pu/235U needed to sustain a chain reaction, as well as the ratio of breeding to fission.
Artificial intelligence provides a number of tools that are useful to bad actors, such as authoritarian governments, terrorists, criminals or rogue states. There are many ways in which AI is expected to help bad actors, some of which cannot be foreseen. For example, machine-learning AI is able to design tens of thousands of toxic molecules in a matter of hours.
Sources: en.wikipedia.org
(2026) identify bone fragments and teeth from the Pleistocene strata from the Bianfu Cave (Yunnan, China) as Denisovan remains, while Ruan et al. (2026) study archaeological remains associated with Denisovan fossils from the Bianfu Cave, interpreted as indicative of specialized hunting, expedient production of stone tools and extensive use of unmodified bones by Denisovans. Hublin et al. (2026) report the discovery of new, approximately 773,000-years-old hominin fossils from Grotte à Hominidés at Thomas Quarry I in Casablanca (Morocco), close in age to Homo antecessor but morphologically distinct from members of this species, preserving a combination of primitive and derived traits seen in Eurasian archaic hominins and in Homo sapiens. Evidence from the study of a stratified sequence of lithic assemblages ranging from Acheulian to the Middle Stone Age from the Amanzi Springs archaeological site (South Africa), indicative of emergence of the Middle Stone Age in the studied area around 230,000 years ago, is presented by Blackwood et al. (2026). Evidence of consistent and specialized extraction of hornfels for the production of stone tools between 220,000 and 110,000 years ago is reported from the Jojosi site (South Africa) by Will et al. (2026). Beyene et al. (2026) report the discovery of approximately 100,000-years-old human skeletons and Middle Stone Age artifacts from the Halibee member of the Dawaitoli Formation (Ethiopia), interpreted as preserved in a wooded depositional environment with seasonal flooding. Zimmer et al.
==== Transformation of kerogen into fossil fuels ==== Kerogen formation continued to a depth of about 1 km from the Earth's surface where temperatures may reach around 50 °C. Kerogen formation represents a halfway point between organic matter and fossil fuels: kerogen can be exposed to oxygen, oxidize and thus be lost, or it could be buried deeper inside the Earth's crust and be subjected to conditions which allow it to slowly transform into fossil fuels like petroleum. The latter happened through catagenesis in which the reactions were mostly radical rearrangements of kerogen. These reactions took thousands to millions of years, and no external reactants were involved. Due to the radical nature of these reactions, kerogen reacted towards two classes of products: those with low H/C ratio (anthracene or products similar to it) and those with high H/C ratio (methane or products similar to it); i.e., carbon-rich or hydrogen-rich products. Because catagenesis was closed off from external reactants, the resulting composition of the fuel mixture was dependent on the composition of the kerogen via reaction stoichiometry. Three types of kerogen exist: type I (algal), II (liptinic) and III (humic), which were formed mainly from algae, plankton and woody plants (this term includes trees, shrubs and lianas) respectively.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
== History == The natriuretic effects of progesterone were demonstrated in 1955, and the development of spironolactone as a synthetic antimineralocorticoid analogue of progesterone shortly followed this. Spironolactone was first synthesized in 1957, was patented between 1958 and 1961, and was first marketed, as an antimineralocorticoid, in 1959. Gynecomastia was first reported with spironolactone in 1962, and the antiandrogenic activity of the medication was first described in 1969. This shortly followed the discovery in 1967 that gynecomastia is an important and major side effect of AR antagonists. Spironolactone was first studied in the treatment of hirsutism in women in 1978. It has since become the most widely used antiandrogen for dermatological indications in women in the United States. Spironolactone was first studied as an antiandrogen in transgender women in 1986, and has since become widely adopted for this purpose as well, particularly in the United States where cyproterone acetate is not available. Early oral spironolactone tablets showed poor absorption. The formulation was eventually changed to a micronized formulation with particle sizes of less than 50 μg, which resulted in approximately 4-fold increased potency.
Sources: en.wikipedia.org
The names are often used interchangeably in casual writing, but they are not strictly identical. Modified GRF(1-29) refers to the unconjugated analogue carrying only the four substitutions. The version sold as CJC-1295 with DAC includes the albumin binding linker and clears much more slowly.
DAC stands for drug affinity complex, a term describing the maleimidopropionic acid linker. This group forms a covalent bond with the cysteine residue on serum albumin after administration. The resulting adduct is what extends the circulating half life from minutes to days.
No. It is entirely synthetic and does not correspond to any known endogenous peptide. The design starts from human growth hormone releasing hormone and introduces deliberate substitutions. Any biological effect comes from mimicking the natural hormone at its receptor.
Cool, dark, and dry conditions are standard, with storage at minus twenty degrees Celsius or below. Desiccant and sealed vials limit moisture uptake. Repeated warming and cooling of the container is generally avoided.